eft-3p::cas9 plasmid Search Results


pms79  (Addgene inc)
92
Addgene inc pms79

Pms79, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pms79/product/Addgene inc
Average 92 stars, based on 1 article reviews
pms79 - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

Image Search Results


Journal: microPublication Biology

Article Title: Expansion of the split hygromycin toolkit for transgene insertion in Caenorhabditis elegans

doi: 10.17912/micropub.biology.001091

Figure Lengend Snippet:

Article Snippet: pMS79 , Cas9 + guide plasmid targeting ChrII landing pad , eef-1A.1 p::Cas9 + U6p::GGACAGTCCTGCCGAGGTGG , ​​ ​ , Addgene.

Techniques: Plasmid Preparation, Generated, Marker, Clone Assay, Expressing